Nucleotide sequence of a cDNA encoding mouse beta casein.
نویسندگان
چکیده
Beta casein 1s a major «1 Ik protein produced by the lactating mammary gland and I t s gene expression 1s hormonally controlled ( 1 ) . cDKAs encoding mouse beta casein wore Isolated from a muse maoaary gland l ibrary prepared as described ( 2 ) , using a short cONA clona of mouse beta casein (1) as a hybridization probe. The longest cDNA clone was chossn and the DNA sequence of each strand was detorained by the chain termination nethod [ 3 ) . Templates for sequencing were prepared by either delation (4) or Hu phege Insertion (K. Mizuuchi, personal communication). The sequence of 1120 bp minus the polyA t a l l 1s presented below with the deduced ami no add sequence. The nucleotide sequence Includes 55 bp of the 5'-untranslated region, the 693 bp coding region and 372 bp of the 3'-untranslated region. Comparison of our data with those reported for rat beta casein (5) revealed 66% homo Logy at the nucleotide level and 78% homo logy at the emino add level , which Includes 100* horology at the 15 aalno acid residues of signal peptide.
منابع مشابه
Nucleotide sequence of cDNA encoding for preprochymosin in native goat (Capra hircus) from Iran
Prochymosin is one of the most important aspartic proteinases used as a milk-clotting enzyme in cheese production. In the present investigation we report sequence of cDNA encoding goat ( Capra hircus ) preprochymosin and compare its nucleotide and deduced amino acid sequences with sequences of other ruminants preprochymosin. As bovine prochymosin, the caprine prochymosin cDNA encodes 365 amino ...
متن کاملIdentification of bacterial clones encoding bovine caseins by direct immunological screening of the cDNA library.
A sensitive immunoassay was used to identify recombinant plasmids carrying cDNA fragments of bovine caseins in the cDNA library from bovine mammary gland mRNA. Colonies grown on nitrocellulose filters were lysed in situ and proteins from the lysates were blotted onto CNBr-activated cellulose filter paper. Antigens covalently bound to CNBr-activated paper or bound to nitrocellulose filters were ...
متن کاملProlactin-dependent growth and gamma-casein gene expression in Ba/F3 cells transfected with a long form of mouse mammary prolactin receptor.
Complementary DNA (cDNA) encoding a long form of prolactin receptor (PRL-RL) was cloned from mouse mammary gland by PCR using primers designed from the noncoding regions of previously reported rat ovarian PRL-RL cDNA. The nucleotide sequence encoding the extracellular and transmembrane domains of PRL-RL is completely identical to that of short forms of mouse PRL-R. The amino acid sequence deduc...
متن کاملRapid communication: nucleotide sequence of the river buffalo beta-casein cDNA.
Name of the Sequence. River buffalo kappa-casein cDNA. Genus and Species. Bubalus arnee bubalis. Origin of the Clone. Ten micrograms of total RNA from mammary tissue of lactating buffalo was reverse-transcribed using an oligo d(T)17 primer and superscript II reverse transcriptase (GIBCO-BRL, Grand Island, NY). The forward primer (5′GTGACAAGGAAAGGTGCAATG3′) was designed from conserved regions, t...
متن کاملLocalization of the casein gene family to a single mouse chromosome
A series of mouse-hamster somatic cell hybrids containing a variable number of mouse chromosomes and a constant set of hamster chromosomes have been used to determine the chromosomal location of a family of hormone-inducible genes, the murine caseins. Recombinant mouse cDNA clones encoding the alpha-, beta-, and gamma-caseins were constructed and used in DNA restriction mapping experiments. All...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید
ثبت ناماگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید
ورودعنوان ژورنال:
- Nucleic acids research
دوره 14 20 شماره
صفحات -
تاریخ انتشار 1986